|
Alomone Labs
anti vesicular ach transporter Anti Vesicular Ach Transporter, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/vesicular+acetylcholine+transporter/Anti-Vesicular+Acetylcholine+Transporter+(VAChT)+Antibody/pmc07452855-77-20-26 Average 93 stars, based on 1 article reviews
anti vesicular ach transporter - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
OriGene
primer vacht f gctgtttgcttccaaggctatcc r gaaggcgaacaggactgtagag ![]() Primer Vacht F Gctgtttgcttccaaggctatcc R Gaaggcgaacaggactgtagag, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/vesicular+acetylcholine+transporter/Vesicular+Acetylcholine+Transporter+(SLC18A3)+Human+qPCR+Primer+Pair/pmc12337169-78-0-7 Average 93 stars, based on 1 article reviews
primer vacht f gctgtttgcttccaaggctatcc r gaaggcgaacaggactgtagag - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Boster Bio
vesicular acetylcholine transporter ![]() Vesicular Acetylcholine Transporter, supplied by Boster Bio, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/vesicular+acetylcholine+transporter/Anti-Vesicular+Acetylcholine+Transporter%2FSLC18A3+Antibody+Picoband/pm37827341-89-64-69 Average 92 stars, based on 1 article reviews
vesicular acetylcholine transporter - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
ImmunoStar inc
goat polyclonal antibody to the vesicular acetylcholine transporter (vacht) ![]() Goat Polyclonal Antibody To The Vesicular Acetylcholine Transporter (Vacht), supplied by ImmunoStar inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/vesicular+acetylcholine+transporter/goat+anti+vesicular+acetylcholine+transporter++vacht+/pmc04586042-70-6-10 Average 90 stars, based on 1 article reviews
goat polyclonal antibody to the vesicular acetylcholine transporter (vacht) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Euro Diagnostica
vesicular acetylcholine transporter (vacht; 1:2,400; euro-diagnostica, malmö, sweden) ![]() Vesicular Acetylcholine Transporter (Vacht; 1:2,400; Euro Diagnostica, Malmö, Sweden), supplied by Euro Diagnostica, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/vesicular+acetylcholine+transporter/vesicular+acetylcholine+transporter++vacht++1+2+400++euro+diagnostica++malm%C3%B6++sweden++antibody/pmc00015804-30-42-47 Average 90 stars, based on 1 article reviews
vesicular acetylcholine transporter (vacht; 1:2,400; euro-diagnostica, malmö, sweden) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Biomol GmbH
antibody to vesicular acetylcholine transporter vacht ab2052813 ![]() Antibody To Vesicular Acetylcholine Transporter Vacht Ab2052813, supplied by Biomol GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/vesicular+acetylcholine+transporter/antibody+to+vesicular+acetylcholine+transporter+vacht+ab2052813/pm29588252-83-24-28 Average 90 stars, based on 1 article reviews
antibody to vesicular acetylcholine transporter vacht ab2052813 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
NeuroRx Research
vesicular acetylcholine transporter inhibitors ![]() Vesicular Acetylcholine Transporter Inhibitors, supplied by NeuroRx Research, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/vesicular+acetylcholine+transporter/vesicular+acetylcholine+transporter+inhibitors/10__1021_slash_jm400664x-627-28-0 Average 90 stars, based on 1 article reviews
vesicular acetylcholine transporter inhibitors - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Biomol GmbH
anti rat/mouse vacht antibody (vesicular acetylcholine transporter) ![]() Anti Rat/Mouse Vacht Antibody (Vesicular Acetylcholine Transporter), supplied by Biomol GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/vesicular+acetylcholine+transporter/anti+rat+mouse+vacht+antibody++vesicular+acetylcholine+transporter+/pmc05063282-96-14-20 Average 90 stars, based on 1 article reviews
anti rat/mouse vacht antibody (vesicular acetylcholine transporter) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Euro Diagnostica
rabbit polyclonal anti-vesicular acetylcholine transporter (vacht), 9690, 1:1200 ![]() Rabbit Polyclonal Anti Vesicular Acetylcholine Transporter (Vacht), 9690, 1:1200, supplied by Euro Diagnostica, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/vesicular+acetylcholine+transporter/rabbit+polyclonal+anti+vesicular+acetylcholine+transporter++vacht+++9690++1+1200/pmc03051387-157-21-29 Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-vesicular acetylcholine transporter (vacht), 9690, 1:1200 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Chata Biosystems
vesicular acetylcholine transporter ![]() Vesicular Acetylcholine Transporter, supplied by Chata Biosystems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/vesicular+acetylcholine+transporter/vesicular+acetylcholine+transporter/pm37446277-141-21-15 Average 90 stars, based on 1 article reviews
vesicular acetylcholine transporter - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Promega
vesicular acetylcholine transporter (vacht) ![]() Vesicular Acetylcholine Transporter (Vacht), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/vesicular+acetylcholine+transporter/vesicular+acetylcholine+transporter++vacht+/pmc06136699-14-0-8 Average 90 stars, based on 1 article reviews
vesicular acetylcholine transporter (vacht) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Absolute Biotech Inc
vesicular acetylcholine transporter ![]() Vesicular Acetylcholine Transporter, supplied by Absolute Biotech Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/vesicular+acetylcholine+transporter/acetylcholine+transporter+vesicular/pmc07144400-197-9-13 Average 86 stars, based on 1 article reviews
vesicular acetylcholine transporter - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: STAR Protocols
Article Title: Protocol to derive postganglionic parasympathetic neurons using human pluripotent stem cells for electrophysiological and functional assessment
doi: 10.1016/j.xpro.2025.104001
Figure Lengend Snippet: Markers for human pluripotent stem cell-derived parasympathetic neurons (A) Expression of ChAT, VAChT, CHRNB4, and NPY2R by immunofluorescence for d30 parasympathetic neurons derived from either spheroid plating (top) or dissociated plating (bottom). (B) Gene expression of d30 parasympathetic neuron markers ( ASCL1, PHOX2B, PRPH, CHRNA3, ChAT, VAChT, NPY2R ) by RT-qPCR derived either through spheroid plating (left) or dissociated plating (right). n= 5 biological replicates.
Article Snippet:
Techniques: Derivative Assay, Expressing, Immunofluorescence, Gene Expression, Quantitative RT-PCR
Journal: Biochemical pharmacology
Article Title: CDP-choline modulates cholinergic signaling and gut microbiota to alleviate DSS-induced inflammatory bowel disease.
doi: 10.1016/j.bcp.2023.115845
Figure Lengend Snippet: Fig. 3. Effect of CDP-choline on ACh synthesis-related proteins in colonic tissue of mice. (A) The representative image of ChT1, ChAT, VAChT, AChE, TNF-α, and IL-6 expression among the three groups. Histogram of the relative expressions of ChT1 (B), ChAT (C), VAChT (D), AChE (E), TNF-α (F), and IL-6 (G), respectively (n = 6). (H) Histogram of ChAT activity in the colon among the three groups measured by ELISA (n = 8). Data are expressed as mean ± SEM. * P < 0.05, ** P < 0.01, *** P < 0.001.
Article Snippet: The membranes were sealed (20 °C, 12 min) in protein-free rapid blocking buffer (EpiZyme, PS108P, China) and incubated overnight at 4 °C in the following primary antibody: β-Actin (1:1000, Cell Signaling Technology, #3700, USA), Occludin (1:1000, Cell Signaling Technology, #91131, USA), High-affinity choline transporter (SLC5A7/ChT1 1:1000, ThermoFisher, PA5-42485, USA), Choline acetyltransferase (ChAT, 1:1000, Cell Signaling Technology, #27269, USA), Acetylcholinesterase (AChE, 1:1500, Abcam, ab183591, UK),
Techniques: Expressing, Activity Assay, Enzyme-linked Immunosorbent Assay
Journal: PLoS ONE
Article Title: VGF Protein and Its C-Terminal Derived Peptides in Amyotrophic Lateral Sclerosis: Human and Animal Model Studies
doi: 10.1371/journal.pone.0164689
Figure Lengend Snippet: Immunohistochemistry in the ventral horn (A), reveals that in the WT mice, at the pre- symptomatic stage, the VGF antibody labels a number of cell bodies other than axons and terminals. The VAChT instead stains exclusively perikarya in a large number and with a punctate labeling around the cell membranes. All perikarya positive for the VGF antibody were identified as motor neurons (merge panel) by the VAChT labelling (arrows identify the cell bodies positive for both antibodies). Instead, in the G93A-SOD1 mice, at the same pre-symptomatic stage, the VGF staining is strikingly reduced also in motor neurons while the VAChT staining instead, remains visible. The cell body feebly reactive for VGF is identified as motor neuron through a double staining. Red (Cy3) and green (Alexa-488) staining: VGF C-terminus and VAChT, respectively. Result data are from 4 sets of experiments for each case. Scale bars: 50 μm.
Article Snippet: Double immunofluorescence experiments were carried out mixing the anti VGF antiserum with the anti
Techniques: Immunohistochemistry, Labeling, Staining, Double Staining
Journal: PLoS ONE
Article Title: Microvillous cells in the olfactory epithelium express elements of the solitary chemosensory cell transduction signaling cascade
doi: 10.1371/journal.pone.0202754
Figure Lengend Snippet: Antisera used to characterize TRPM5-positive MV cells.
Article Snippet:
Techniques: Marker, Concentration Assay, Transduction
Journal: PLoS ONE
Article Title: Microvillous cells in the olfactory epithelium express elements of the solitary chemosensory cell transduction signaling cascade
doi: 10.1371/journal.pone.0202754
Figure Lengend Snippet: A-A′′ . Antisera against ChAT labels TRPM5-GFP-positive MVCs. B-B′′ . The antisera against TRPM5 colocalizes with the ChAT-GFP-positive MVCs. C-C′′ . VAChT immunoreactivity in TRPM5-GFP-positive MVCs.
Article Snippet:
Techniques:
Journal: Molecules
Article Title: A Novel Alternative in the Treatment of Detrusor Overactivity? In Vivo Activity of O-1602, the Newly Synthesized Agonist of GPR55 and GPR18 Cannabinoid Receptors
doi: 10.3390/molecules25061384
Figure Lengend Snippet: The influence of O-1602 administration in female rats with detrusor overactivity induced by RA on the level of ( A ) CGRP, ( B ) ERK1/2, ( C ) OCT 3 in the bladder urothelium, ( D ) VAChT in the bladder detrusor muscle, ( E ) BDNF, and ( F ) NGF in the urine. One-way ANOVA: F(3,56) = 119.1, p < 0.0001 for CGRP; F(3,56) = 136.8, p < 0.0001 for ERK1/2; F(3,56) = 143.5, p < 0.0001 for OTC 3 ; F(3,56) = 164.3, p < 0.0001 for VAChT; F(3,56) = 200.4, p < 0.0001 for BDNF; F(3,56) = 136.4, p < 0.0001 for NGF. All results are presented as the means ± SEM ( n = 15 rats per group). The obtained data were assessed by the one-way ANOVA followed by Tukey’s post hoc test. *, ^, or ×: p < 0.05; **, ^^, or ××: p < 0.01; ***, ^^^, or ×××: p < 0.001; ****, ^^^^, or ××××: p < 0.0001. *: Significantly different from the CON; ^: Significantly different from the RA group; ×: Significantly different from the RA + O-1602 group. Abbreviations: BDNF—brain-derived neurotrophic factor; CGRP—calcitonin gene related peptide; ERK1/2– extracellular signal-regulated kinase 1/2; NGF—nerve growth factor; O-1602—agonist of GPR55 and GPR18 cannabinoid receptors; OCT 3 —organic cation transporter 3; RA—retinyl acetate; VAChT—vesicular acetylcholine transporter.
Article Snippet: Additionally, in the bladder detrusor muscle, the levels of
Techniques: Derivative Assay
Journal: Molecules
Article Title: A Novel Alternative in the Treatment of Detrusor Overactivity? In Vivo Activity of O-1602, the Newly Synthesized Agonist of GPR55 and GPR18 Cannabinoid Receptors
doi: 10.3390/molecules25061384
Figure Lengend Snippet: Biochemical study parameters.
Article Snippet: Additionally, in the bladder detrusor muscle, the levels of
Techniques: Activity Assay, Control, Produced