Journal: STAR Protocols

Article Title: Protocol to derive postganglionic parasympathetic neurons using human pluripotent stem cells for electrophysiological and functional assessment

doi: 10.1016/j.xpro.2025.104001

Figure Lengend Snippet: Markers for human pluripotent stem cell-derived parasympathetic neurons (A) Expression of ChAT, VAChT, CHRNB4, and NPY2R by immunofluorescence for d30 parasympathetic neurons derived from either spheroid plating (top) or dissociated plating (bottom). (B) Gene expression of d30 parasympathetic neuron markers ( ASCL1, PHOX2B, PRPH, CHRNA3, ChAT, VAChT, NPY2R ) by RT-qPCR derived either through spheroid plating (left) or dissociated plating (right). n= 5 biological replicates.

Article Snippet: Primer: VAChT F: GCTGTTTGCTTCCAAGGCTATCC R: GAAGGCGAACAGGACTGTAGAG , OriGene , HP206648.

Techniques: Derivative Assay, Expressing, Immunofluorescence, Gene Expression, Quantitative RT-PCR

Journal: Biochemical pharmacology

Article Title: CDP-choline modulates cholinergic signaling and gut microbiota to alleviate DSS-induced inflammatory bowel disease.

doi: 10.1016/j.bcp.2023.115845

Figure Lengend Snippet: Fig. 3. Effect of CDP-choline on ACh synthesis-related proteins in colonic tissue of mice. (A) The representative image of ChT1, ChAT, VAChT, AChE, TNF-α, and IL-6 expression among the three groups. Histogram of the relative expressions of ChT1 (B), ChAT (C), VAChT (D), AChE (E), TNF-α (F), and IL-6 (G), respectively (n = 6). (H) Histogram of ChAT activity in the colon among the three groups measured by ELISA (n = 8). Data are expressed as mean ± SEM. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: The membranes were sealed (20 °C, 12 min) in protein-free rapid blocking buffer (EpiZyme, PS108P, China) and incubated overnight at 4 °C in the following primary antibody: β-Actin (1:1000, Cell Signaling Technology, #3700, USA), Occludin (1:1000, Cell Signaling Technology, #91131, USA), High-affinity choline transporter (SLC5A7/ChT1 1:1000, ThermoFisher, PA5-42485, USA), Choline acetyltransferase (ChAT, 1:1000, Cell Signaling Technology, #27269, USA), Acetylcholinesterase (AChE, 1:1500, Abcam, ab183591, UK), Vesicular acetylcholine transporter (SLC18A3/VAChT, 1:1000, Boster Bio, A04891, China), α7 nicotinic acetylcholine receptor (CHRNA7/α7 nAChR, 1:1000, Proteintech, 21379–1-AP, China), Tumor necrosis factor-α (TNF-α, 1:1000, Cell Signaling Technology, #11948, USA), Interleukin 6 (IL-6, 1:1000, HUABIO, R1412-2, China) and ZO-1 (1:1500, Bioswamp, PAB36669, China).

Techniques: Expressing, Activity Assay, Enzyme-linked Immunosorbent Assay

Journal: PLoS ONE

Article Title: VGF Protein and Its C-Terminal Derived Peptides in Amyotrophic Lateral Sclerosis: Human and Animal Model Studies

doi: 10.1371/journal.pone.0164689

Figure Lengend Snippet: Immunohistochemistry in the ventral horn (A), reveals that in the WT mice, at the pre- symptomatic stage, the VGF antibody labels a number of cell bodies other than axons and terminals. The VAChT instead stains exclusively perikarya in a large number and with a punctate labeling around the cell membranes. All perikarya positive for the VGF antibody were identified as motor neurons (merge panel) by the VAChT labelling (arrows identify the cell bodies positive for both antibodies). Instead, in the G93A-SOD1 mice, at the same pre-symptomatic stage, the VGF staining is strikingly reduced also in motor neurons while the VAChT staining instead, remains visible. The cell body feebly reactive for VGF is identified as motor neuron through a double staining. Red (Cy3) and green (Alexa-488) staining: VGF C-terminus and VAChT, respectively. Result data are from 4 sets of experiments for each case. Scale bars: 50 μm.

Article Snippet: Double immunofluorescence experiments were carried out mixing the anti VGF antiserum with the anti rat/mouse VAChT antibody (vesicular acetylcholine transporter; BIOMOL Research lab, Plymouth Meeting, PA; 1:400 dilution), raised in different donor species (rabbit and goat, respectively).

Techniques: Immunohistochemistry, Labeling, Staining, Double Staining

Journal: PLoS ONE

Article Title: Microvillous cells in the olfactory epithelium express elements of the solitary chemosensory cell transduction signaling cascade

doi: 10.1371/journal.pone.0202754

Figure Lengend Snippet: Antisera used to characterize TRPM5-positive MV cells.

Article Snippet: Vesicular acetylcholine transporter (VAChT) , Cholinergic cells , Promega G448A , 8302401 , goat; 1:1,000.

Techniques: Marker, Concentration Assay, Transduction

Journal: PLoS ONE

Article Title: Microvillous cells in the olfactory epithelium express elements of the solitary chemosensory cell transduction signaling cascade

doi: 10.1371/journal.pone.0202754

Figure Lengend Snippet: A-A′′ . Antisera against ChAT labels TRPM5-GFP-positive MVCs. B-B′′ . The antisera against TRPM5 colocalizes with the ChAT-GFP-positive MVCs. C-C′′ . VAChT immunoreactivity in TRPM5-GFP-positive MVCs.

Article Snippet: Vesicular acetylcholine transporter (VAChT) , Cholinergic cells , Promega G448A , 8302401 , goat; 1:1,000.

Techniques:

Journal: Molecules

Article Title: A Novel Alternative in the Treatment of Detrusor Overactivity? In Vivo Activity of O-1602, the Newly Synthesized Agonist of GPR55 and GPR18 Cannabinoid Receptors

doi: 10.3390/molecules25061384

Figure Lengend Snippet: The influence of O-1602 administration in female rats with detrusor overactivity induced by RA on the level of ( A ) CGRP, ( B ) ERK1/2, ( C ) OCT 3 in the bladder urothelium, ( D ) VAChT in the bladder detrusor muscle, ( E ) BDNF, and ( F ) NGF in the urine. One-way ANOVA: F(3,56) = 119.1, p < 0.0001 for CGRP; F(3,56) = 136.8, p < 0.0001 for ERK1/2; F(3,56) = 143.5, p < 0.0001 for OTC 3 ; F(3,56) = 164.3, p < 0.0001 for VAChT; F(3,56) = 200.4, p < 0.0001 for BDNF; F(3,56) = 136.4, p < 0.0001 for NGF. All results are presented as the means ± SEM ( n = 15 rats per group). The obtained data were assessed by the one-way ANOVA followed by Tukey’s post hoc test. *, ^, or ×: p < 0.05; **, ^^, or ××: p < 0.01; ***, ^^^, or ×××: p < 0.001; ****, ^^^^, or ××××: p < 0.0001. *: Significantly different from the CON; ^: Significantly different from the RA group; ×: Significantly different from the RA + O-1602 group. Abbreviations: BDNF—brain-derived neurotrophic factor; CGRP—calcitonin gene related peptide; ERK1/2– extracellular signal-regulated kinase 1/2; NGF—nerve growth factor; O-1602—agonist of GPR55 and GPR18 cannabinoid receptors; OCT 3 —organic cation transporter 3; RA—retinyl acetate; VAChT—vesicular acetylcholine transporter.

Article Snippet: Additionally, in the bladder detrusor muscle, the levels of vesicular acetylcholine transporter (VAChT, LifeSpan BioSciences, CN LS-F12924-1) were estimated, in the urine, the concentration of nerve growth factor (NGF, LifeSpan BioSciences, CN LS-F25946-1) and of brain-derived neurotrophic factor (BDNF, Promega, CN G7610) were determined.

Techniques: Derivative Assay

Journal: Molecules

Article Title: A Novel Alternative in the Treatment of Detrusor Overactivity? In Vivo Activity of O-1602, the Newly Synthesized Agonist of GPR55 and GPR18 Cannabinoid Receptors

doi: 10.3390/molecules25061384

Figure Lengend Snippet: Biochemical study parameters.

Article Snippet: Additionally, in the bladder detrusor muscle, the levels of vesicular acetylcholine transporter (VAChT, LifeSpan BioSciences, CN LS-F12924-1) were estimated, in the urine, the concentration of nerve growth factor (NGF, LifeSpan BioSciences, CN LS-F25946-1) and of brain-derived neurotrophic factor (BDNF, Promega, CN G7610) were determined.

Techniques: Activity Assay, Control, Produced